Royalty Report: Drugs, Diagnostic, Drug Discovery – Collection: 1953

$150.00

Curated Royalty Rate Report
Category: Technology Licenses, Created On: 2022-04-28, Record Count: 12

Description

This collection of transactions and supporting information was developed using our AI algorithm to curate similar royalty reports into a cohesive collection to support your licensing, transfer pricing or other transaction scenarios where documented royalty rates and/or deal terms are important.
Category: Technology Licenses
Created On: 2022-04-28
Record Count: 12

Primary Industries

  • Drugs
  • Diagnostic
  • Drug Discovery
  • Biotechnology
  • Medical
  • Therapeutic
  • ribonucleic acid
  • Disease
  • Proteins
  • Antibody
  • Device
  • cardiac
  • Cancer

IPSCIO Report Record List

Below you will find the records curated into this collection.  This summary includes the complete licensed property description so that you can review and determine if this collection covers the topics, technology or transaction type that is relevant for your needs.  The full report will include all relevant deal data such as the royalty base, agreement date, term description, royalty rates and other deal terms.  For reference, here is a sample of a full IPSCIO curated royalty rate report: Sample Report

IPSCIO Record ID: 1953

License Grant
The University assigned to the Company all of URC’s present and future rights to (i) inventions falling within the scope of the claims contained in issued patents and pending patent applications for the SELEX process technology; a powerful combinatorial chemistry technology known as the SELEX process that rapidly identifies novel oligonucleotide compounds with potential therapeutic and diagnostic benefits.
License Property
The SELEX process can rapidly identify compounds that bind tightly and selectively to molecular targets.  The SELEX process is designed to create and screen a pool of up to one million billion (1,000,000,000,000,000) single-stranded and uniquely shaped oligonucleotides and to select from such pool a family of ligands which has the highest affinity for a specified molecular target.  The SELEX process begins by creating in a test tube a pool containing a million billion candidate oligonucleotides, molecules belonging to the same family as DNA and RNA but typically modified to resist degradation by DNA- and RNA-destroying enzymes.

IPSCIO Record ID: 328117

License Grant
Licensor hereby grants to Licensee the following licenses during the term of this Agreement (a) a non-exclusive, non-sublicenseable license under the Licensed IP Rights, to use the Selex Process, for the purpose of identifying and developing anti-protein Aptamers for use solely as part of a Licensed Product (the Research License) and (b) an exclusive, worldwide license under the Licensed IP Rights, with the right to grant Sublicenses as set forth in this agreement, to develop, manufacture, use, sell, offer for sale, have sold, and import Licensed Products solely for use in the Field (the Commercial License). For the avoidance of doubt, the Research License shall include the right to test potential Licensed Products in animals.
License Property
U.S. 5,650,275 – Target detection method using spectroscopically detectable nucleic acid ligands
U.S. 5,641,629 – Spectroscopically detectable nucleic acid ligands
U.S. 5,475,096 – Nucleic acid ligands

Licensor owns or has rights in certain technology regarding aptamers and their modifications. Aptamers bind to molecular targets much like antibodies but are more easily reproduced.

Aptamers shall mean oligonucleotides, including any structural variations and modifications, derivatives, homologs, analogs and/or mimetics thereof, identified through the Selex Process.

Licensed Product shall mean a product that contains an Aptamer, other than an Excluded Aptamer, with Anti-Fibrin Activity, and that has, as another component, a nucleic acid that has Anti-Fibrin Antidote Activity, wherein the discovery, development, manufacture, use, sale or importation of such product would infringe a Valid Claim within the Licensed Patent Rights but for the grant and continuing validity of the license granted by Licensor to Licensee in this agreement hereof. In addition, if Licensee manufactures, uses, sells, offers for sale, has sold or imports a product that would constitute a Licensed Product but for the fact that Licensee did not discover or develop the Aptamer contained within such product, then, that product shall be deemed to be within the definition of the term Licensed Product for all purposes hereunder. For avoidance of doubt, in addition to the foregoing requirements, a product must have therapeutically significant levels of both Anti-Fibrin Activity and Anti-Fibrin Antidote Activity in order to be a Licensed Product.

Selex Process means any process for the identification of a nucleic acid, which process is disclosed in or falls within the claimed scope of the Licensed Selex Patent Rights.

Licensed Patent Rights shall mean any and all patents or patent applications Controlled during the Term by Licensor that are necessary or useful for the performance of the Selex Process or the manufacture, sale, offer for sale, importation or use of Aptamers, excluding the Excluded Aptamers, within the Field, including, without limitation, the Licensed Selex Patent Rights; provided, however, that patents and patent applications claiming the composition or use of specific Aptamers shall not be included within the definition of Licensed Patent Rights except to the extent they are included within the Licensed Selex Patent Rights.

The SELEXâ„¢ process enables us to incubate a large number of nucleic acid sequences with a specific target protein to more efficiently identify aptamers with the necessary structural and binding properties. Additionally, we use a proprietary process to establish the optimal conditions for performing the SELEXâ„¢ process to each target protein, which we believe provides for a high probability of success in identifying potent aptamers.

Field of Use
Aptamers are single-stranded nucleic acids (RNA or DNA) that bind to specific protein targets with high affinity and specificity. The first drug from this new class of therapeutics, Eyetech's Macugen, has just demonstrated high efficacy for the treatment of age-related macular degeneration in Phase III clinical trials.

Field shall mean the use of a Licensed Product for the treatment of diseases or conditions in humans caused or characterized by factors involved in, and the modulation of, fibrin deposition, platelet adhesion and/or platelet aggregation; provided, however, that the Field shall not include the treatment of any conditions or diseases of the eye, the orbit and its contents, the eyelids or the lacrimal system in humans or animals. The Field shall not include the diagnosis of any diseases or conditions nor any uses relating to the handling or storage of blood or blood products.

IPSCIO Record ID: 372478

License Grant
Licensor hereby grants to Licensee an exclusive, royalty-bearing license, including the right to grant sublicenses, under the Licensed Patent Rights and Licensed Technology, to Develop, have Developed, make, have made, use, have used, sell, offer for sale, distribute for sale, have sold, import, have imported, export and have exported, Licensed Products in the Territory, for any and all uses within the Field, subject to the terms and conditions of this Agreement. For purposes of clarity, (a) if the PDGF Expanded License Term ends for any reason prior to the end of the Term, Licensee’s rights in the Expanded Field pursuant to the foregoing license shall terminate at the end of the PDGF Expanded License Term and the foregoing license shall thereafter be limited to the Ophthalmic Field, (b) Licensee shall have the exclusive right under this license to use SELEX Technology for the sole purpose of modifying Anti-PDGF Aptamers for use in the Field, (c) Licensee shall have no right under this license to practice the SELEX Process for any other reason, including to identify or modify aptamers, and (d Licensor shall retain the right to use the Licensed Technology and practice the Licensed Patent Rights to (i) research, develop, have developed, make, have made, use, have used, sell, offer for sale, have sold, distribute for sale, import, have imported, export and have exported any product that is not a Licensed Product in the Field and (ii) research, develop, have developed, make, have made, use, have used, sell, offer for sale, have sold, distribute for sale, import, have imported, export and have exported any Licensed Product outside the Field.
License Property
6,207,816 – High affinity oligonucleotide ligands to growth factors
6,229,002 – Platelet derived growth factor (PDGF) nucleic acid ligand complexes
7,141,375 – Methods and compositions for treatment of tumors using nucleic acid ligands to platelet-derived growth factor

Licensed Product means any pharmaceutical product comprised of or Derived from, in whole or in part, any Anti-PDGF Aptamer.

Anti-PDGF Aptamer means an Aptamer that binds with high specificity and affinity to PDGF, including without limitation ARC127, ARC404, E10030 and any other Aptamer that binds with high specificity and affinity to PDGF as set out in the issued patents and pending patent applications listed in Exhibit A and any Aptamer(s) Derived therefrom that bind with high specificity and affinity to PDGF.

Aptamer means (a) any naturally or non-naturally occurring oligonucleotide identified through the SELEX Process that binds with high specificity and affinity to a Target, and (b) any pegylated or unpegylated oligonucleotide Derived from an oligonucleotide of clause (a) that has such high specificity and affinity to a Target.

SELEX Process means any means used for the identification or generation of a nucleic acid that binds to a Target by means other than Watson-Crick base-pairing, including, without limitation, any process that (a) is covered by the SELEX Portfolio, including, without limitation, U.S. Patent Nos. 5,270,163 or 5,843,653, (b) is covered by any other Patent Rights Controlled by Licensor, or (c) is covered by any continuation, divisional, continuation-in-part, substitution, renewal, reissue, re-examination or extension, or any foreign equivalent of, the foregoing Patent Rights.

Field of Use
Anti-PDGF aptamer or anti-C5 aptamer is for the prevention, treatment, cure or control of human indications, diseases, disorders or conditions of the eye, adnexa of the eye, orbit and optic nerve, other than certain expressly excluded applications.

Field means, collectively, the Ophthalmic Field and, during the PDGF Expanded License Term, the Expanded Field.  Expanded Field means the prevention, treatment, cure or control of all Indications outside of the Ophthalmic Field.

IPSCIO Record ID: 209505

License Grant
Licensor grants an exclusive license under the Licensed Patents and Know How to make, have made, use, sell, offer to sell, import and export the Product within the Field throughout the Territory, with a right to sublicense to its Affiliates or to any other Person.
License Property
The compound NX1838, is an oligonucleotide angiogenesis inhibitor that binds to vascular endothelial growth factor (VEGF165).

VEGF is known to play a role in the development of both ophthalmic diseases.

The Product shall mean any pharmaceutical composition containing NX1838 in any formulation, dosage concentration or volume, together with all label expansions, line extensions and improvements thereon, which may be included in any supplement, modification or addition to the filings for Regulatory Approval of the foregoing compound.

Field of Use
The Field shall mean the prevention and treatment of all human and other animal diseases and conditions, and expressly excluding in vivo and in vitro diagnostic applications.

NX 1838 has the potential to be a breakthrough drug for the treatment of neovascular AMD.

AMD is the leading cause of vision loss and blindness in people aged 65 and older. The disease is characterized by the growth of blood vessels into the center of the retina. Over time, the leakage from these small blood vessels causes the formation of scar tissue on the retina. A patient’s central vision gradually deteriorates as the disease destroys the retina, ultimately resulting in irreversible blindness. The two common types of AMD are atrophic ('dry') and neovascular ('wet'). Wet macular degeneration accounts for approximately 10 percent of all cases but is a more serious threat to complete vision loss than the dry form.

IPSCIO Record ID: 531

License Grant
Licensor hereby grants undisclosed Licensee and its Affiliates a world-wide, nonexclusive, royalty-bearing license (without the right to grant sublicenses) under Patent Rights (i) to research and develop, make, have made, use, sell and have sold Licensed Products in the Field of Use and (ii) to research and develop, make and use Licensed Intermediates in the Field of Use for sale or transfer to any Third Party Transferee.
License Property
Licensor has the right to grant licenses to and under certain technology described and claimed in U.S. Patent No. 5,223,409 entitled Directed Evolution of Novel Binding Proteins, U.S. Patent No. 5,403,484 entitled Viruses Expressing Chimeric Binding Proteins, and U.S. Patent No. 5,571,698 entitled Directed Evolution of Novel Binding Proteins, U.S. Patent No.  5,837,500 entitled Directed Evolution of Novel Binding Proteins, and associated patent rights.  

'LICENSED INTERMEDIATE' shall mean any fusion protein (including without limitation any chimeric binding protein), genetic package (including without limitation any virus, spore or cell) or other intermediate compound, or any compound derived from any of the foregoing, that is (i) discovered, made or developed by Licensee using a method covered by Patent Rights or (ii) is otherwise covered by Patent Rights.

Licensed Product shall mean any product intended for sale to an End User as an In Vitro diagnostic or research reagent, and sold in the form of an immunoassay kit or vial containing one or more antibodies as a binding moiety that is discovered, made or developed, whether by Licensee, its Affiliates or any Third Party Transferee, using a Licensed Intermediate or a method covered by Patent Rights.

Field of Use
Field of Use shall mean human In Vitro diagnostic or research reagent uses, and not for any therapeutic, In Vivo diagnostic, purification or separations, agricultural, industrial enzymes or other purposes.

IPSCIO Record ID: 223131

License Grant
Licensee hereby grants to Licensor a worldwide, non-exclusive license under the Research Program Technology and Licensor Inhibition Mode Technology solely to perform its obligations under the Research Program as specifically provided in the Research Plan.

Licensor hereby grants to Licensee and its Affiliates a worldwide, non-exclusive license under the Licensor Core Technology (and any improvements thereto) to research, develop, make, have made, use, import, offer for sale, sell, have sold or otherwise exploit compounds that inhibit the Target (including but not limited to Program Compounds) and/or Products in the Territory.

Licensor hereby grants to Licensee and its Affiliates a worldwide, non-exclusive license under the Licensor Background Technology to research, develop, make, have made, use, import, offer for sale, sell, have sold or otherwise exploit compounds that inhibit the Target (including but not limited to Program Compounds) and/or Products in the Territory.

License Property
Research Program means the activities undertaken by or under authority of Licensee, which may include input from Licensor and the Licensor Principal Consultant, to discover and develop Program Compounds as set forth and in the Research Plan.

Research Program Technology means Research Program Know-How and Research Program Patents.
Research Program Patents mean Licensee Research Program Patents, Licensor Research Program Patents, and Joint Research Program Patents.

Licensor Inhibition Mode Technology means Licensor Inhibition Mode Patents and Licensor Inhibition Mode Know-How.

Patents within the Licensor Core Technology.
U.S. Patent No. 6,344,330 – Pharmacophore Recombination For the Identification of Small Molecule Drug Lead Compounds
U.S. Patent No. 6,335,155 – Methods for rapidly identifying small organic molecule ligands for binding to biological target molecules

Licensor Core Technology mean all patents, patent applications, invention disclosures, certificates of invention and applications for certificates of invention, owned or Controlled by Licensor or its Affiliates as of the Agreement’s Effective Date and/or during the term of the Agreement, and all information, materials and other subject matter, and improvements thereof, relating to (i) mutants or the use thereof in screening, (ii) the use of novel protein engineering techniques and their application in drug discovery, (iii) target-directed fragment discovery and maturation to produce drug leads, including monophores, extenders and fragments, and monophore, extender and fragment libraries for such purposes, (iv) covalent tethering and techniques related thereto (e.g., NMR, X-ray, mass spec. AUC, Biacore) and its use to discover fragments and test binding hypotheses of fragments and leads, or (v) dynamic and other combinatorial chemistries related to proteins, as well as any divisions, continuations, continuations-in-part, reissues, reexaminations, extensions, supplementary protection certificates, and other governmental actions which extend any of the patent applications, patents, invention disclosures, certificates of invention or certificates of invention applications above, and all foreign counterparts to any of the foregoing.  Notwithstanding the foregoing, Licensor Core Technology shall exclude all Licensor Inhibition Mode Technology and Research Program Technology.

Licensor Background Technology means all patents, patent applications, invention disclosures, certificates of invention and applications for certificates of invention, Controlled by Licensor or its Affiliates as of the Effective Date and/or during the term of the Agreement, that (i) are necessary or useful to Licensee in the research, development, or commercialization of compounds that inhibit the Target (including but not limited to Program Compounds and Products), and (ii) are not Licensor Inhibition Mode Patents, Research Program Patents or within the Licensor Core Technology; as well as any divisions, continuations, continuations-in-part, reissues, reexaminations, extensions, supplementary protection certificates, and other governmental actions which extend any of the patent applications, patents, invention disclosures, certificates of invention or certificates of invention applications above, and all foreign counterparts to any of the foregoing.

Field of Use
Research collaboration agreement relates to discover novel oral drugs for the treatment of viral infections.

IPSCIO Record ID: 370550

License Grant
Licensor licensed a worldwide exclusive right (on a target by target basis), under Licensor’s patent portfolio (122 patents and patent applications) and proprietary information and know-how relating to its modified SELEX processes and modified aptamers technology to make, use, sell, and have made, and have sold (a) commercial products produced by or incorporating Licensor licensed technologies and (b) commercial products intended for use in nucleic acid amplification that are rationally designed nucleic acid sequences that is a temperature dependent inhibitor of a licensed target. Licensor retained a non-exclusive right to make, use and have made the aptamers for internal research and development, including the right to grant non-exclusive licenses to Licensor collaborator for research and development purposes. The Amendment granted such company enforcement of licensed patent rights against third-party infringers to exclude in vivo imaging applications in the licensed field and licensed product.
License Property
SELEX (Systematic Evolution of Ligands by Exponential enrichment), a process typically short (e.g., approximately 20-50`mer) synthetic ssDNA sequences developed to bind specific protein targets. The power of the SELEX process comes from the intrinsic propensity of ssDNA to fold into unique three-dimensional shapes in solution. This means a large collection of ssDNA molecules represents a large collection of shapes, which include protein-like functional groups added to the 5-position of deoxyuridine residues of each reagent, bind to proteins with significantly higher affinity and specificity as compared to conventional unmodified aptamers, and identify functionally-active proteins in their native state rather than linearized epitopes (as many antibody based approaches do), or possible fragments of protein (as mass spectrometry, protein fingerprinting and “sequencing” technologies do).

Aptamers which are short, synthetic single stranded DNA (ssDNA) sequences developed to bind specific protein targets with high affinity and specificity across the proteome.

Field of Use
Field of Use is for research and development of drugs relating to proteins and antibodies.

IPSCIO Record ID: 29089

License Grant
Licensee is hereby granted the non-exclusive right to make and have made, to use and to have used, to sell and have sold Licensed Products and to practice Licensed Processes and to use the Technology, in the Territory, all in accordance with this Agreement.
License Property
ViriChipâ„¢ A novel, patented device for detection and identification of known and unknown pathogens. US Patent No. 6,897,015 and US Patent Application No. 20050239193
Chip On A Tipâ„¢ (COAT) A patented ultraminiaturized device for detection of biomarkers from extremely small sample volumes (e.g., a single cell). US Patent No. 7,344,832
Force Panning A patented method for differentiating between materials bound to surfaces by virtue of their binding force. US Patent No. 7,060,448 and US Patent Application No. 20050059091
Force Assessment Screening Technology (FAST) A novel method for screening intermolecular interactions based on direct force measurements at the molecular level. US Patent Application No. 20030186311

CellWellâ„¢ A novel device for detection of multiple biomarkers from a single cell.
NanoArrays. Protein arrays with sub-micron feature sizes. US Patent No. 6,573,369

IPSCIO Record ID: 301257

License Grant
Licensor and Licensee will design and identify morpholino and morpholino peptide conjugate splice switching oligomers that modulate the splicing of Licensor-Licensee Exclusive Targets and the Licensee Exclusive Targets. For each Licensor-Licensee Exclusive Target, Licensee will provide Splicing Modulators to be tested for their ability to modulate splicing.

General Overview. Licensor and Licensee will identify and develop Splicing Modulators that modulate the splicing of Licensor-Licensee Exclusive Targets and Licensee Exclusive Targets, as more specifically described in the Research Plan.

Licensor grants to Licensee an exclusive worldwide license to the Splicing Patents solely to research, develop, make and have made, offer for sale, sell, import and export Licensee Exclusive Products.

License Property
Product means an Licensor-Licensee Exclusive Product or an Licensee Exclusive Product, or both.

Licensor-Licensee Exclusive Products are a fixed pool of exclusive Gene Targets for research and development efforts to discover and develop Products that modify such exclusive Gene Targets to develop Splicing Modulators.

Licensee owns or controls certain patents related to morpholino chemistry.

Licensor-Licensee Exclusive Product means a Splicing Modulator that modulates an Licensor-Licensee Exclusive Target and that is Covered by the Licensee Patents and/or an Licensor Invention Patent.

Licensee Exclusive Product means a Splicing Modulator that modulates an Licensee Exclusive Target and is Covered by the Splicing Patents and/or an Licensee Invention Patent.

Splicing Modulator means an oligonucleotide or analog thereof that selectively modulates RNA Splicing or polyadenylation by a non-Rnase dependent mechanism at the nucleic acid level by specifically binding to the sequence of a selected messenger or viral ribonucleic acid (RNA) by base-pairing, thus causing a selective pattern of gene expression.

Licensee Patents means the patent(s) listed.
5,142,047 – Uncharged polynucleotide-binding polymers

Splicing Patents means the Isis Splicing Patents and the Licensor Splicing Patents.

Licensor Splicing Patents means the patent(s) listed.
5,976,879 – Antisense oligonucleotides which combat aberrant splicing and methods of using the same

Isis Splicing Patents means the patent(s) listed.
6,210,892 – Alteration of cellular behavior by antisense modulation of mRNA processing

Licensee Invention Patent and/or Licensor Invention Patent has the meaning depending how any Inventions are made under the Research Plan will define if it is an Licensor Invention or an Licensee Invention, as the case may be, and Patents claiming such Inventions will be Licensor Invention Patents or Licensee Invention Patents, respectively.

Licensor-Licensee Exclusive Target also known as Gene Targets that are selected for their research and development efforts.
List of the five selected Targets
TNFRl
TNFR2
He.r2
BCL-X
CD28

Licensee Exclusive Target also known as Gene Targets that are selected for their research and development efforts.
List of the five selected Targets
PDl
CTLA4
TGF beta
P53
IL23

Field of Use
This agreement pertains to the drug industry related to RNA splicing in the areas of drug discovery and medicinal chemistry,

IPSCIO Record ID: 367588

License Grant
Licensor hereby grants to Licensee a worldwide, non-exclusive license, without the right to grant sublicenses, under the Licensed Technology and Licensed Patent Rights, for the sole purpose of conducting Research on Short Acting Coagulation Cascade Aptamers identified by Licensor in the course of performance of Research.

Licensor hereby grants to Licensee an exclusive (even as to Licensor), worldwide, sublicensable license under the Licensed Technology and Licensed Patent Rights, to Develop, Commercialize, make, have made, use, have used, sell, have sold, lease, offer for sale or lease, import and export Development Compounds and Licensed Products within the Field.

License Property
Licensor is responsible for the discovery of short-acting aptamers targeting the coagulation cascade for use in acute cardiovascular procedures.

Licensed Product means a product that comprises, consists of, or which incorporates a Development Compound regardless of its formulation or mode of administration.

Development Compound
(a) means any Candidate Compound that is discovered or made by Licensor under the Original Agreement or this Agreement and selected by Licensee for IND-enabling studies and designated by Licensee as Development Compound pursuant to this Agreement;
(b) any compound Derived from a Development Compound, as defined in subsection (a) above, under the Original Agreement or this Agreement that is a Short Acting Coagulation Cascade Aptamer (for clarity, any such compound defined in this subsection (b) shall be designated as a separate Development Compound under this Agreement); and
(c) ARC 2172.

ARC 2172 means the Aptamer having the nucleotide sequence set forth.
CGCCTAGGTTGGGTAGGGTGGTGGCG

Aptamer means any oligonucleotide that binds to a target through means other than Watson-Crick base-pairing.

Licensed Technology means any Licensor Technology that (a) specifically relates to any Candidate Compound, Development Compound or Licensed Product relevant to the license grant, or (b) is necessary or useful for Licensee to exercise the relevant licenses granted to it pursuant to this Agreement.

Candidate Compound means an Aptamer that is a Short Acting Coagulation Cascade Aptamer that is identified by Licensor in the course of its Research under this Agreement pursuant to an approved Research Plain.

Licensed Patent Rights means any Licensor Patent Rights (a) to the extent claiming any Compound Technology, Candidate Compound, Development Compound or Licensed Product or the manufacture thereof or the use thereof in the Field, or (b) that are necessary or useful for Licensee to exercise the relevant licenses granted to it pursuant to Agreement. For clarity, the Licensed Patent Rights shall exclude any Patent Rights that relate to the Selex Inventions or the Selex Technology and shall include, without limitation, the following United States Patents and their counterparts throughout the world to the extent not Selex Inventions or Selex Technology 6,334,318 B1; 5,476,766; 5,543,293; 5,582,981; 5,688,291; 5,817,785; 5,840,867; and 6,331,398 B1.
6,334,318 – Automatic ice making apparatus
5,476,766 – Ligands of thrombin
5,543,293 – DNA ligands of thrombin

Field of Use
NU172 is an aptamer that directly inhibits thrombin's ability to generate fibrin, the protein that provides the scaffolding for blood clots. Data from early animal models suggest that NU172 is a potent anticoagulant that offers the potential for predictable anticoagulant effects, rapid onset and offset of action, reduced bleeding complications and no risk of heparin induced thrombocytopenia. Licensee has already commenced IND-enabling studies with NU172.

Field means the use of Short Acting Coagulation Cascade Aptamers to Modulate blood clotting times in acute therapeutic applications, including but not limited to coronary artery bypass graft surgery and percutaneous coronary intervention. Filed does not include (a) the use of any Radio Therapeutic Aptamer; (b) any Aptamer that is not a Short Acting Coagulation Cascade Aptamer; (c) any non-therapeutic use of Aptamers, including, but not limited to, In Vitro Diagnostics and/or other diagnostic uses, use of an Aptamer as a reagent or use of an Aptamer in or as a non-therapeutic service; or (d) any use of a Short Acting Coagulation Cascade Aptamer in conjunction with a second nucleic acid component, where the additional nucleic acid component is used to affect r terminate the activity of the Short Acting Coagulation Cascade Aptamer. For clarity, if any Short Acting Coagulation Cascade Aptamers Developed under this Agreement for use in the Field, as described in the previous sentences, have additional therapeutic uses, those additional therapeutic uses will also be considered part of the Field.

IPSCIO Record ID: 291167

License Grant
Licensee and Licensor will design and identify morpholino and morpholino peptide conjugate splice switching oligomers that modulate the splicing of Licensee-Licensor Exclusive Targets and the Licensor Exclusive Targets. For each Licensee-Licensor Exclusive Target, Licensor will provide Splicing Modulators to be tested for their ability to modulate splicing.

Licensee and Licensor will design and identify morpholino and morpholino peptide conjugate splice switching oligomers that modulate the splicing of Licensee-Licensor Exclusive Targets and the Licensor Exclusive Targets. For each Licensee-Licensor Exclusive Target, Licensor will provide Splicing Modulators to be tested for their ability to modulate splicing.

General Overview. Licensee and Licensor will identify and develop Splicing Modulators that modulate the splicing of Licensee-Licensor Exclusive Targets and Licensor Exclusive Targets, as more specifically described in the Research Plan.

Licensor grants Licensee the following licenses
Licensor grants Licensee an exclusive worldwide license to the Licensor Patents solely to research, develop, offer for sale, sell, import and export Licensee-Licensor Exclusive Products.

License Property
Product means an Licensee-Licensor Exclusive Product or an Licensor Exclusive Product, or both.

Licensor-Licensee Exclusive Products are a fixed pool of exclusive Gene Targets for research and development efforts to discover and develop Products that modify such exclusive Gene Targets to develop Splicing Modulators.

Licensor owns or controls certain patents related to morpholino chemistry.

Licensee-Licensor Exclusive Product means a Splicing Modulator that modulates an Licensee-Licensor Exclusive Target and that is Covered by the Licensor Patents and/or an Licensee Invention Patent.

Licensor Exclusive Product means a Splicing Modulator that modulates an Licensor Exclusive Target and is Covered by the Splicing Patents and/or an Licensor Invention Patent.

Splicing Modulator means an oligonucleotide or analog thereof that selectively modulates RNA Splicing or polyadenylation by a non-Rnase dependent mechanism at the nucleic acid level by specifically binding to the sequence of a selected messenger or viral ribonucleic acid (RNA) by base-pairing, thus causing a selective pattern of gene expression.

Licensor Patents means the patent(s) listed.
5,142,047 – Uncharged polynucleotide-binding polymers

Splicing Patents means the Isis Splicing Patents and the Licensee Splicing Patents.

Licensee Splicing Patents means the patent(s) listed.
5,976,879 – Antisense oligonucleotides which combat aberrant splicing and methods of using the same

Isis Splicing Patents means the patent(s) listed.
6,210,892 – Alteration of cellular behavior by antisense modulation of mRNA processing

Licensor Invention Patent and/or Licensee Invention Patent has the meaning depending how any Inventions are made under the Research Plan will define if it is an Licensee Invention or an Licensor Invention, as the case may be, and Patents claiming such Inventions will be Licensee Invention Patents or Licensor Invention Patents, respectively.

Licensee-Licensor Exclusive Target also known as Gene Targets that are selected for their research and development efforts.
List of the five selected Targets
TNFRl
TNFR2
He.r2
BCL-X
CD28

Licensor Exclusive Target also known as Gene Targets that are selected for their research and development efforts.
List of the five selected Targets
PDl
CTLA4
TGF beta
P53
IL23

Field of Use
This agreement pertains to the drug industry related to RNA splicing in the areas of drug discovery and medicinal chemistry,

IPSCIO Record ID: 4619

License Grant
The license relates to the use of blocked primers in combination with HDA (Helicase Dependent Amplification).  It is exclusive to the fields of amplification utilizing HDA and detection of diagnostic targets in human in-vitro diagnostic testing, but is non-exclusive to all oncology and human papilloma virus targets or markers.
License Property
HDA, is a process that utilizes an enzyme, helicase, to unwind double-stranded DNA to create two single strands through isothermal, or single temperature, amplification. Once this DNA is single-stranded, complementary DNA primers, which are short pieces of DNA that are complementary to the DNA target, can hybridize. Through the action of an enzyme, DNA polymerase, the DNA primers grow, or extend, to create a complementary strand of the DNA target, creating double-stranded DNA again. This process can be repeated and the degree of copying, or amplification, is exponential, so that billions of copies can be created. HDA is a method already commercially available for detection of DNA targets, however, it is a mistake-prone process. DNA primers can incorrectly hybridize to non-target DNA at lower temperatures and be copied, creating so-called primer artifacts, which leads to tests that are slow and poorly sensitive.  The proprietary target amplification approach, termed blocked primer-mediated, helicase-dependent amplification, or bpHDA, utilizes blocked primers to enhance test speed and sensitivity. Blocked primers are DNA primers that contain a block at lower temperatures, where most incorrect hybridization events occur, preventing extension of the DNA primers or copying of the DNA target. As the temperature is raised, incorrect hybridization events are not stable and fall apart, but hybridization of DNA primers to complementary DNA targets is still very strong and an enzyme, RNase H, becomes active which can remove the block in blocked primers hybridized to DNA targets only. As a result, the accuracy of the process is dramatically improved, leading to faster and more sensitive tests. In order to label the DNA target for detection, each DNA primer has a biotin molecule attached to one end.
Disclaimer: The information gathered from RoyaltySource® database was sourced from the U.S. Securities and Exchange Commission EDGAR Filings and other public records. While we believe the sources to be reliable, this does not guarantee the accuracy or completeness of the information provided. Further, the information is supplied as general guidance and is not intended to represent or be a substitute for a detailed analysis or professional judgment. This information is for private use only and may not be resold or reproduced without permission.